Story #7780

[FUSE] Write a FUSE performance pipeline

Added by Brett Smith over 4 years ago. Updated about 4 years ago.

Assigned To:
Target version:
Start date:
Due date:
% Done:


Estimated time:
(Total: 0.00 h)
Story points:


Write a pipeline that copies data (5-10GB) from the FUSE mount to a local temporary file. Test each of the following methods in sequence in the pipeline:

  • shell 'cp' from mount
  • Python shutil.copy from mount
  • arv-get
  • A Python loop that copies from a CollectionReader() to an open file

Write a message after each copy is done so it's possible to collect timing stats up to that point. Then do a checksum on the file and verify that it's not corrupt.


Task #7789: ReviewResolvedPeter Amstutz

Task #7796: Implement different methods to fetch from keepResolvedPeter Amstutz


#1 Updated by Brett Smith over 4 years ago

  • Description updated (diff)
  • Category set to FUSE

#2 Updated by Brett Smith over 4 years ago

  • Assigned To set to Peter Amstutz

#3 Updated by Peter Amstutz over 4 years ago

1st run

arv-get: 54.547s
collection: 39.7725520134
cp: 39.635s
shutil: 37.7655129433

#4 Updated by Peter Amstutz over 4 years ago

2nd run

arv-get: 1m41.320s
collection: 38.4127969742
cp: 40.311s
shutil: 37.6932270527

3rd & 4th run
arv-get: 40.937s
arv-get: 41.551s

#5 Updated by Peter Amstutz over 4 years ago

Seems to be averaging 45 MiB/s

First one (arv-get) seems to be affected by cache freshness issues, running it last gives better numbers.

cpu utilization:

arv-get: cpu 10.5500 user 10.1400 sys
collection: cpu 12.5100 user 10.5600 sys
cp: cpu 0.0200 user 1.7600 sys
shutil: cpu 2.5400 user 2.3600 sys

I think this just means arv-mount's CPU utilization isn't being charged to the copy commands like it is to arv-get and CollectionReader.

#6 Updated by Peter Amstutz over 4 years ago

strace -c arv-get 0b2b39e4da4b51d40dcfc12f47af4e04+1249/lobSTR_ref.fasta .

% time     seconds  usecs/call     calls    errors syscall
------ ----------- ----------- --------- --------- ----------------
 31.94    1.363753           2    808788           clock_gettime
 26.46    1.129736          10    115231           recvfrom
 23.16    0.988879         275      3601           write
  9.10    0.388444           2    230682           poll

Not sure why it's calling clock_gettime 800k times. Also recvfrom() is only reading 16k at a time which seems too small for the data transfer rate we're trying to achieve.

#7 Updated by Ward Vandewege over 4 years ago

Peter Amstutz wrote:


Not sure why it's calling clock_gettime 800k times.

Known issue, you need to set an env var. See

#8 Updated by Ward Vandewege over 4 years ago

Ward Vandewege wrote:

Peter Amstutz wrote:


Not sure why it's calling clock_gettime 800k times.

Known issue, you need to set an env var. See

Hmm, maybe I spoke too soon. We set TZ to avoid the excessive stat'ing of /etc/localtime in some places on our clusters. But it doesn't seem to help with all the clock_gettime calls.

#9 Updated by Peter Amstutz over 4 years ago

The inner receiver loop (which is presumably all libcurl or pycurl) looks like this:

poll([{fd=11, events=POLLIN}], 1, 1000) = 1 ([{fd=11, revents=POLLIN}])
clock_gettime(CLOCK_MONOTONIC, {4137158, 906951004}) = 0
poll([{fd=11, events=POLLIN|POLLPRI|POLLRDNORM|POLLRDBAND}], 1, 0) = 1 ([{fd=11, revents=POLLIN|POLLRDNORM}])
recvfrom(11, "TTTTCAGGGTTTCACTCTGTCACCCAGGCTGG"..., 16384, 0, NULL, NULL) = 16384
clock_gettime(CLOCK_MONOTONIC, {4137158, 907006204}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907018404}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907030204}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907042004}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907053504}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907065504}) = 0
poll([{fd=11, events=POLLIN}], 1, 1000) = 1 ([{fd=11, revents=POLLIN}])
clock_gettime(CLOCK_MONOTONIC, {4137158, 907091504}) = 0
poll([{fd=11, events=POLLIN|POLLPRI|POLLRDNORM|POLLRDBAND}], 1, 0) = 1 ([{fd=11, revents=POLLIN|POLLRDNORM}])
recvfrom(11, "TTCTCAACATTTCGCCTAGCAACTCCCCCAGG"..., 16384, 0, NULL, NULL) = 16384
clock_gettime(CLOCK_MONOTONIC, {4137158, 907144704}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907157004}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907168804}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907192504}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907204004}) = 0
clock_gettime(CLOCK_MONOTONIC, {4137158, 907215904}) = 0
poll([{fd=11, events=POLLIN}], 1, 1000) = 1 ([{fd=11, revents=POLLIN}])

#16 Updated by Nico César about 4 years ago

I ran this job and works

c97qk (azure blob store, 2 keepstore servers):
throwaway 149.83417511
arv-get 106.32137084
CollectionReader 104.115087986
cp 105.585179806
shutil 96.5133240223

LGTM for what is worth.

As a whishlist I'd like to add more data to the final table so we have the possibility to compare over time like:

about the run itself

  • bytes sent
  • cpu (us sy id wa st if possible)
  • highest usage of memory (whatever is the easiest way to measure this.)
  • io activity (whatever is the easiest way to measure this.)
  • latency to the rest of the components (like an average of 5 pings to API, keep servers, etc)

about the environment

  • keep server/services available
  • version of arvados components
  • /proc/cpu_info and lshw or something similar to gives us a clue which cloud and size we're dealing with (ideally API server should provide all this details including the size of all the components)
  • keep block size

there are more to add but I'll be happy if just start with that and collect the info over time

#17 Updated by Peter Amstutz about 4 years ago

  • Status changed from New to Resolved

#18 Updated by Peter Amstutz about 4 years ago

"throwaway" task

4xphq 55.6503009796, 56.6268150806, 58.0175321102
c97qk 106.220340014, 85.2707979679, 106.330720901, 113.038635015
qr1hi 38.397521019 101s

#19 Updated by Peter Amstutz about 4 years ago

warmup: 56.9406909943
arvget: 56.6816000938

warmup: 434.597276211
arvget: 40.413373947

Also available in: Atom PDF